ifunny.co
Open in
urlscan Pro
38.134.113.246
Public Scan
Submitted URL: http://ifunny.co/
Effective URL: https://ifunny.co/
Submission: On June 22 via manual from US — Scanned from DE
Effective URL: https://ifunny.co/
Submission: On June 22 via manual from US — Scanned from DE
Form analysis
0 forms found in the DOMText Content
memepedia log in Animals & Nature Anime & Manga Art & Creative Cars Celebrities Gaming Girls Internet Memes Movies Other Politics Science & Tech Sports TV shows log in add meme 00:33:05 featured top memes memes catalog Animals & Nature Anime & Manga Art & Creative Cars Celebrities Gaming Girls Internet Memes Movies Other Politics Science & Tech Sports TV shows trending channels WTFAnimalsGamesComicVideoSportsiFunny OriginalsWholesome Wednesday❤ App Store Google Play memepedia about app privacy terms public relations Q&A iFunny guidelines feedback © iFunny 2023 Ev3lynh 17h 1.3K45 Copy linkPinterest On my way to find them #way#find kdawg69 2h 3295 Copy linkPinterest BB linux > windows Megamind is unattractive 142.234.12.73 I 722 rs_hutch ATGCTCTTAGGTCTAGATCTATGGAACTCATCG 427 vevader_3 trans rights 1 Award Did you just doxx his genetic sequence #funnymemes#memes#funny#collective#feature#featured#featureworthy#bb#linux#windows#megamind#unattractive#atgctcttaggtctagatctatggaactcatcg#rights#award#did#just#doxx#genetic#sequence Whitey375 16h 2.3K48 Copy linkPinterest TITANIC FATALITIES #titanic#fatalities Freedom_Supremacy 6h 61137 Copy linkPinterest VicariousZeus 8h 63944 Copy linkPinterest Rest here soldier, you've seen too many Ocean Gate memes #rest#here#soldier#youve#seen#too#ocean#gate#memes Greenhornet224 7h 46535 Copy linkPinterest Are your freedoms really more important than my false sense of security?? Yes. #guncontrol#gunrights#twitter#freedom#polotics#joebiden#ar15#goa#fpc#guns4life#freedoms#really#more#important#false#sense#yes Mars_Yard 16h 57243 Copy linkPinterest The Hunter Biden hi walking away wit Mainstream no prison time Media after selling Crack and: committing Treason in his father's name look, missing submarine! #hunter#biden#hi#walking#away#wit#mainstream#prison#time#media#selling#committing#treason#fathers#name#look#missing#submarine KingBender 13h 3997 Copy linkPinterest ATTENTION BILLIONAIRES I AM WILLING DROP YOU IN THE NORTH ATLANTIC FOR ONLY $100,000 (60% DISCOUNT!) #attention#rich#mfs#billionaires#am#willing#drop#north#atlantic#only#discount JugsMcBulge95 2d 1.1K29 Copy linkPinterest Nobody wrists Kramat, what's here? #wrists#kramat#whats Quat 3h 1778 Copy linkPinterest new Pokemon region looks like shit fortnite creative map what happened #nintendo#pokemon#new#region#looks#fortnite#creative#map#happened 1 2 3 … 100 » trending channels WTFAnimalsGamesComicVideoSportsiFunny OriginalsWholesome Wednesday❤ App Store Google Play memepedia about app privacy terms public relations Q&A iFunny guidelines feedback © iFunny 2023