crispr.dbcls.jp
Open in
urlscan Pro
133.39.78.69
Public Scan
Submitted URL: http://crispr.dbcls.jp/
Effective URL: https://crispr.dbcls.jp/
Submission: On November 14 via api from US — Scanned from JP
Effective URL: https://crispr.dbcls.jp/
Submission: On November 14 via api from US — Scanned from JP
Form analysis 2 forms found in the DOM
Name: getsequence — GET ./
<form name="getsequence" method="GET" action="./">
<p>Enter an accession number (e.g. NM_006299) or genome location (e.g. hg19:chr7:900000-901000): <span style="vertical-align:-0.4ex">
<a href="doc/accession.html" onclick="window.open(
'doc/accession.html','','width=600,height=700,scrollbars=yes'
) ; return false ;">
<img src="qicon.png" alt="?" width="15" height="15" border="0">
</a></span><br>
<input type="text" id="acc" name="accession" size="40" maxlength="80" value="">
<input type="submit" value="retrieve sequence">
</p>
</form>Name: crisprdirect — POST ./
<form name="crisprdirect" method="POST" action="./" enctype="multipart/form-data">
<div>
<p>or Paste a nucleotide sequence: <a href="doc/input.html" onclick="window.open(
'doc/input.html','','width=600,height=700,scrollbars=yes'
) ; return false ;">
<img src="qicon.png" alt="?" width="15" height="15" border="0">
</a><br>
<textarea id="useq" name="userseq" rows="15" cols="90" class="mono">>sample sequence
atgccgcgcgtcgtgcccgaccagagaagcaagttcgagaacgaggagttttttaggaag
ctgagccgcgagtgtgagattaagtacacgggcttcagggaccggccccacgaggaacgc
caggcacgcttccagaacgcctgccgcgacggccgctcggaaatcgcttttgtggccaca
ggaaccaatctgtctctccagttttttccggccagctggcagggagaacagcgacaaaca
cctagccgagagtatgtcgacttagaaagagaagcaggcaaggtatatttgaaggctccc
atgattctgaatggagtctgtgttatctggaaaggctggattgatctccaaagactggat
ggtatgggctgtctggagtttgatgaggagcgagcccagcaggaggatgcattagcacaa
caggcctttgaagaggctcggagaaggacacgcgaatttgaagatagagacaggtctcat
cgggaggaaatggaggcaagaagacaacaagaccctagtcctggttccaatttaggtggt
ggtgatgacctcaaacttcgttaa
</textarea>
</p>
<p>or upload sequence file: <span style="vertical-align:-0.4ex">
<a href="doc/upload.html" onclick="window.open(
'doc/upload.html','','width=600,height=700,scrollbars=yes'
) ; return false ;">
<img src="qicon.png" alt="?" width="15" height="15" border="0">
</a>
</span>
<input type="file" name="upload" size="40">
</p>
<p>PAM sequence requirement: <input type="text" id="pam" name="pam" size="15" maxlength="15" value="NGG"> (e.g. NGG, NRG, NNGRRT, NG) <span style="vertical-align:-0.4ex">
<a href="doc/pam.html" onclick="window.open(
'doc/pam.html','','width=600,height=700,scrollbars=yes'
) ; return false ;">
<img src="qicon.png" alt="?" width="15" height="15" border="0">
</a>
</span>
</p>
<p class="db">Specificity check: </p>
<div class="dblist-render" id="ext-gen1701">
<table class="x-field x-table-plain x-form-item x-form-type-text x-field-default x-border-box" style="width: 737px; table-layout: fixed;" cellpadding="0" id="crisprdirect-combobox-dblist">
<tbody>
<tr role="presentation" id="crisprdirect-combobox-dblist-inputRow" class="x-form-item-input-row">
<td role="presentation" id="crisprdirect-combobox-dblist-labelCell" style="display:none;" valign="top" halign="left" width="105" class="x-field-label-cell"><label id="crisprdirect-combobox-dblist-labelEl"
for="crisprdirect-combobox-dblist-inputEl" class="x-form-item-label x-unselectable x-form-item-label-left" style="width:100px;margin-right:5px;" unselectable="on"></label></td>
<td role="presentation" class="x-form-item-body " id="crisprdirect-combobox-dblist-bodyEl" colspan="3" style="width: 100%;">
<table id="crisprdirect-combobox-dblist-triggerWrap" class="x-form-trigger-wrap" cellpadding="0" cellspacing="0" style="width: 100%; table-layout: fixed;">
<tbody>
<tr>
<td id="crisprdirect-combobox-dblist-inputCell" class="x-form-trigger-input-cell" style="width: 100%;">
<div class="x-hide-display x-form-data-hidden" role="presentation" id="ext-gen1707"><input type="hidden" name="db" value="hg19"></div><input id="crisprdirect-combobox-dblist-inputEl" type="text"
class="search x-form-required-field x-form-text" autocomplete="off" value="Human (Homo sapiens) genome, GRCh37/hg19 (Feb, 2009)" name="crisprdirect-combobox-dblist-inputEl" aria-invalid="false" data-errorqtip=""
style="width: 100%;">
</td>
<td valign="top" class=" x-trigger-cell x-unselectable" style="width:22px;" id="ext-gen1706">
<div class="x-trigger-index-0 x-form-trigger x-form-arrow-trigger x-form-trigger-first" role="button" id="ext-gen1705"></div>
</td>
</tr>
</tbody>
</table>
</td>
</tr>
</tbody>
</table>
</div>
<span style="vertical-align:-0.4ex">
<a href="doc/selectdb.html" onclick="window.open(
'doc/selectdb.html','','width=600,height=700,scrollbars=yes'
) ; return false ;">
<img src="qicon.png" alt="?" width="15" height="15" border="0">
</a>
</span>
<p></p>
<input type="hidden" id="acc2" name="accession" value="">
<p><input type="submit" class="zbutton" value=" design "></p>
</div>
<div>
<h5>Whats' new:</h5>
<ul>
<li>2020-11-07 Added mouse genome GRCm39/mm39. </li>
<li>2020-09-11 Longer/shorter PAM supported. (e.g. NNGRRT, NG) </li>
<li>2018-05-07 Added 12 genomes - <a target="_blank" href="https://github.com/meso-cacase/CRISPRdirect/wiki/Database-update-history">List</a>
</li>
<li>2017-12-11 Added carrot genome v2.0 from Phytozome. </li>
<li>2017-11-30 Added 376 genomes from <a target="_blank" href="http://genome.microbedb.jp/cyanobase/">CyanoBase</a> - <a target="_blank" href="https://github.com/meso-cacase/CRISPRdirect/wiki/CyanoBase">List</a>
</li>
<li>2017-11-08 Added 5 species - <a target="_blank" href="https://github.com/meso-cacase/CRISPRdirect/wiki/Database-update-history">List</a>
</li>
<li>2017-06-19 Added 8 species - <a target="_blank" href="https://github.com/meso-cacase/CRISPRdirect/wiki/Database-update-history">List</a>
</li>
<li>2017-06-09 Added Human Japanese Reference Genome JRGv2. </li>
<li>2017-02-17 <i>Brassica rapa</i> genome v1.5 is available. </li>
<li>2017-01-23 Added 8 species - <a target="_blank" href="https://github.com/meso-cacase/CRISPRdirect/wiki/Database-update-history">List</a>
</li>
<li>2016-12-14 CRISPRdirect shows restriction enzyme cutting sites - <a target="_blank" href="doc/REsites.png">Sample</a>
</li>
<li>2016-09-09 Added 10 species - <a target="_blank" href="https://github.com/meso-cacase/CRISPRdirect/wiki/Database-update-history">List</a>
</li>
<li>2016-08-30 Added Human Japanese Reference Genome JRGv1. </li>
<li>2016-06-14 Added 10 species - <a target="_blank" href="https://github.com/meso-cacase/CRISPRdirect/wiki/Database-update-history">List</a>
</li>
<li>2015-10-05 CRISPRdirect supports 200+ species - <a href="doc/#db_list">List of species</a>
</li>
<li>2015-01-13 HTTPS encrypted connections supported - <a href="https://crispr.dbcls.jp/">https://crispr.dbcls.jp/</a>
</li>
<li>2014-11-21 CRISPRdirect paper has been published in <i>Bioinformatics</i> - <a target="_blank" href="http://bioinformatics.oxfordjournals.org/content/31/7/1120.full">
Full text</a>
</li>
<li><a href="doc/#news">News archives</a>
</li>
</ul>
</div>
</form>Text Content
— Rational design of CRISPR/Cas target. -------------------------------------------------------------------------------- Enter an accession number (e.g. NM_006299) or genome location (e.g. hg19:chr7:900000-901000): Enter an accession number (e.g. NM_006299) or genome location (e.g. hg19:chr7:900000-901000): or Paste a nucleotide sequence: >sample sequence atgccgcgcgtcgtgcccgaccagagaagcaagttcgagaacgaggagttttttaggaag ctgagccgcgagtgtgagattaagtacacgggcttcagggaccggccccacgaggaacgc caggcacgcttccagaacgcctgccgcgacggccgctcggaaatcgcttttgtggccaca ggaaccaatctgtctctccagttttttccggccagctggcagggagaacagcgacaaaca cctagccgagagtatgtcgacttagaaagagaagcaggcaaggtatatttgaaggctccc atgattctgaatggagtctgtgttatctggaaaggctggattgatctccaaagactggat ggtatgggctgtctggagtttgatgaggagcgagcccagcaggaggatgcattagcacaa caggcctttgaagaggctcggagaaggacacgcgaatttgaagatagagacaggtctcat cgggaggaaatggaggcaagaagacaacaagaccctagtcctggttccaatttaggtggt ggtgatgacctcaaacttcgttaa or upload sequence file: PAM sequence requirement: (e.g. NGG, NRG, NNGRRT, NG) Specificity check: WHATS' NEW: * 2020-11-07 Added mouse genome GRCm39/mm39. * 2020-09-11 Longer/shorter PAM supported. (e.g. NNGRRT, NG) * 2018-05-07 Added 12 genomes - List * 2017-12-11 Added carrot genome v2.0 from Phytozome. * 2017-11-30 Added 376 genomes from CyanoBase - List * 2017-11-08 Added 5 species - List * 2017-06-19 Added 8 species - List * 2017-06-09 Added Human Japanese Reference Genome JRGv2. * 2017-02-17 Brassica rapa genome v1.5 is available. * 2017-01-23 Added 8 species - List * 2016-12-14 CRISPRdirect shows restriction enzyme cutting sites - Sample * 2016-09-09 Added 10 species - List * 2016-08-30 Added Human Japanese Reference Genome JRGv1. * 2016-06-14 Added 10 species - List * 2015-10-05 CRISPRdirect supports 200+ species - List of species * 2015-01-13 HTTPS encrypted connections supported - https://crispr.dbcls.jp/ * 2014-11-21 CRISPRdirect paper has been published in Bioinformatics - Full text * News archives -------------------------------------------------------------------------------- CRISPRdirect | DBCLS This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0). If you use CRISPRdirect in your work, please cite: Naito Y, Hino K, Bono H, Ui-Tei K. (2015) CRISPRdirect: software for designing CRISPR/Cas guide RNA with reduced off-target sites. Bioinformatics, 31, 1120-1123. [Full Text]